 |
From: TSS (216-119-143-55.ipset23.wt.net)
Subject: Re: Linking chronic wasting disease to scrapie by comparison of Spiroplasma mirum ribosomal DNA sequences [FULL TEXT]
Date: June 28, 2004 at 2:37 pm PST
In Reply to: Re: Linking chronic wasting disease to scrapie by comparison of Spiroplasma mirum ribosomal DNA sequences posted by TSS on June 26, 2004 at 1:53 pm:
-------- Original Message --------
Subject: Linking chronic wasting disease to scrapie by comparison of Spiroplasma mirum ribosomal DNA sequences [FULL TEXT]
Date: Mon, 28 Jun 2004 16:01:26 -0500
From: "Terry S. Singeltary Sr."
Reply-To: Bovine Spongiform Encephalopathy
To: BSE-L@uni-karlsruhe.de
######## Bovine Spongiform Encephalopathy #########
UNCORRECTED PROOF
ARTICLE IN PRESS
1 Linking chronic wasting disease to scrapie by comparison of
2 Spiroplasma mirum ribosomal DNA sequences
3 Frank O. Bastian,a,* Srikanta Dash,a and Robert F. Garryb
4 a Department of Pathology and Laboratory Medicine, Tulane University
Health Sciences Center, New Orleans, LA 70112, USA
5 b Microbiology and Immunology, Tulane University Health Sciences
Center, New Orleans, LA 70112, USA
67
Received 19 January 2004
8 Abstract
9 Transmissible spongiform encephalopathies (TSE) are fatal
neurodegenerative diseases of man and animals and are transmitted by a
10 filterable pathogen whose identity is currently unresolved. Our data
indicates that Spiroplasma, a wall-less bacterium, is involved in the
11 pathogenesis of TSE. We searched for Spiroplasma ribosomal gene
sequences in 10 scrapie-infected sheep brains and 10 normal sheep brains,
12 7 cervid brains infected with chronic wasting disease (CWD), and 7
normal cervid brains. DNA was extracted from these tissue samples and
13 amplified by polymerase chain reaction (PCR) using primers specific
for Spiroplasma-specific 16S rDNA. Specificity of the amplicon was
14 determined by Southern blotting and DNA sequence analyses.
Spiroplasma 16S rDNA was found in 8 of 10 scrapie-infected sheep brains and
15 6 of 7 CWD-infected tissue samples. All normal animal brain samples
were negative. Spiroplasma 16S rDNA was also found in two human
16 Creutzfeldt-Jakob diseased (CJD) brains but not in two age-matched
normal human brains. DNA sequence analyses of the amplified PCR
17 products from human and animal TSE cases revealed greater than 99%
nucleotide sequence homology with Spiroplasma mirum. The
18 presence of Spiroplasma DNA in TSE-infected tissues supports our
hypothesis that Spiroplasma may be involved in the pathogenesis of these
19 diseases.
20 D 2004 Elsevier Inc. All rights reserved.
21
22 Keywords: Prion; Creutzfeldt-Jakob disease; Scrapie; Chronic wasting
disease; Spiroplasma; Ribosome; Transmissible spongiform encephalopathy;
23 Polymerase chain reaction (PCR); Southern blot
24
25 26 Introduction
27 The transmissible spongiform encephalopathies (TSE)
28 are fatal infections of man [Creutzfeldt-Jakob disease
29 (CJD)] and animals [scrapie in sheep and goats, bovine
30 spongiform encephalopathy (BSE) or mad cow disease,
31 transmissible mink encephalopathy (TME) in farmed mink,
32 and chronic wasting disease (CWD)] (Bastian, 1991). Scra-
33 pie has been known for over 300 years (Besnoit, 1899) and
34 has a worldwide distribution. Scrapie is endemic in English
35 sheep and occurs in scattered flocks in the United States
36 (Bastian, 1991). BSE arose in England by transmission of
37 scrapie to cattle through feeding cattle bone meal derived
38 from scrapie-infected sheep (Nathanson et al., 1997). BSE
39 developed to epidemic proportions in England in the 1980s
40 and recently spread to Europe. In 1996, a new variant form
41 of CJD (nvCJD) (Will et al., 1996) was discovered in
42 teenagers in England. This occurrence was alarming, since
43 sporadic CJD usually afflicts patients of 40 to 80 years of
44 age (Brown et al., 1987). NvCJD is characterized by unique
45 neuropathology (Ironside et al., 1996). In addition to spon-
46 giform degeneration, the brains of nvCJD patients contain
47 florid amyloid plaques. This pathology is considered to be
48 sign of increased virulence, since florid plaques have been
49 induced experimentally by serial passage of sporadic CJD
50 tissues in rats (Manuelidis et al., 1997) along with marked
51 shortening of incubation times. Interestingly, florid amyloid
52 plaques are seen in brain tissues of deer infected with CWD
53 (Liberski et al., 2001). CWD now involves up to 30% of the
54 wild deer population and is spreading rapidly from the
55 original loci in Wyoming and Colorado (Spraker et al.,
56 1997). CWD has recently been experimentally transmitted
57 to cattle (Hamir et al., 2001). A reservoir of CWD infection
58 in cervids may be difficult to evaluate, since the disease is
0014-4800/$ - see front matter D 2004 Elsevier Inc. All rights reserved.
doi:10.1016/j.yexmp.2004.02.002
* Corresponding author. Department of Pathology and Laboratory
Medicine, Tulane University Medical Center, 1430 Tulane Avenue, New
Orleans, LA 70112, USA. Fax: +1-504-587-7389.
E-mail address: fbastian@tulane.edu (F.O. Bastian).
www.elsevier.com/locate/yexmp
YEXMP-02583; No. of pages: 9; 4C:
Experimental and Molecular Pathology xx (2004) xxx xxx
UNCORRECTED PROOF
ARTICLE IN PRESS
59 able to persist in animals without clinical signs (Race et al.,
60 2001).
61 Multiple strains of naturally occurring sheep scrapie have
62 been recognized based upon experimental infection in
63 inbred mice wherein they produce distinct incubation peri-
64 ods and disparate lesion profiles (Bruce et al., 2002). Over
65 20 scrapie strains have now been recognized. These strains
66 have been confirmed as independent strains, since they can
67 be reisolated in mice after passage in intermediate species
68 with different host prion gene makeup (Bruce et al., 1994).
69 A study of cervid TSE infections revealed evidence of
70 multiple strains (Race et al., 2002). Different physicochem-
71 ical properties of accumulated prion were recognized in
72 brains of hamsters infected with two distinct strains of TME
73 (Bessen and Marsh, 1992, 1994). This line of investigation
74 was followed by studies by Hill et al. (1997) which showed
75 that new variant CJD is associated with prion glycoform
76 ratios that are distinct from patterns found with classical
77 CJD. This research group showed similar unique prion
78 glycosylation patterns involving BSE, strongly suggesting
79 that nvCJD arose from the British BSE epidemic. However,
80 it appears that tracing origin of TSE cases using that strategy
81 is problematic, since BSE has been found in two dairy cows
82 with a glycosylation pattern resembling sporadic CJD (Cas-
83 alone et al., 2004). Different patterns of prion glycosylation
84 have been described in the same individual with CJD,
85 depending what tissues are sampled (Petersen, 1999), and
86 the small number of prion glycosylation patterns that have
87 been recognized (Safar et al., 2000) does not approach the
88 over 20 suspected strains known for either CJD or scrapie
89 (Bruce et al., 1994). A comprehensive analysis of abnormal
90 prion glycoform patterns in CWD-affected cervids, scrapie-
91 affected sheep, and BSE-affected cattle has failed to reliably
92 distinguish these TSEs (Race et al., 2002). Use of different
93 monoclonals using immunocytochemistry has failed to
94 show different individual patterns based upon the prion
95 (Foster et al., 2001; Kovacs et al., 2002). Therefore,
96 currently, there is no efficient way to link human CJD cases
97 to a particular TSE source.
98 The problem is exemplified in the recent occurrence of
99 CJD in three young people (< 30 years of age) who had
100 consumed venison (Belay et al., 2001) which raised the
101 issue of a possible connection to the CWD epidemic in
102 cervids and possibly represented occurrence of nvCJD in
103 these patients. However, the three young patients showed
104 none of the unique clinical and pathological findings asso-
105 ciated with nvCJD (Ironside, 1996). There was no unique
106 neuropathological pattern, no clinical homogeneity, and no
107 uniformity of codon 129 of the prion gene. Since BSE and
108 nvCJD have been separated from sporadic CJD cases based
109 upon a unique glycosylation pattern of prion on Western
110 blots (Hill et al., 1997), studies were performed on brain
111 tissues from these young CJD patients to determine if there
112 was a link to BSE. All cases revealed prion glycosylation
113 patterns commonly associated with classic variants of CJD.
114 However, the recent report of prion glycosylation patterns in
115 BSE resembling sporadic form of CJD (Casalone et al.,
116 2004) suggests that question whether these cases of CJD are
117 associated with the CWD epidemic cannot be answered
118 using current methodology.
119 We propose that the question of whether there is a link
120 between scrapie, CWD, CJD, and perhaps other TSE may
121 be addressed by looking at DNA sequence patterns related
122 to Spiroplasma ribosomal DNA found to be associated with
123 the disease (Bastian and Foster, 2001). Over the years, we
124 have reported many observations implicating Spiroplasma
125 infection in TSE (Bastian, 1979; Bastian et al., 1980, 1984,
126 1987a,b). Recently, we have reported presence of Spiro-
127 plasma ribosomal DNA in CJD and scrapie-infected brains
128 while not present in controls (Bastian and Foster, 2001). The
129 present study was initiated to validate our previous work by
130 documenting the presence of the Spiroplasma ribosomal
131 DNA in CJD, scrapie, and CWD-infected cervid samples.
132 Importantly, DNA sequence analyses of polymerase chain
133 reaction (PCR) products from probing of individual TSE-
134 infected samples revealed sequence differences in the Spi-
135 roplasma ribosomal gene suggestive of individual strains.
136 Therein, we were able to show a link between scrapie and
137 CWD infections and propose that similar studies could be
138 applicable to study of human CJD cases.
139 Materials and methods
140
141 Tissue samples
142 Two frozen human CJD-infected brain samples were
143 obtained from Dr. Gambetti at the Prion Surveillance
144 laboratory at Case Western Reserve, Cleveland, OH. Con-
145 trol frozen normal human brains were obtained from our
146 institutional pathology service. Frozen brain tissues from 10
147 scrapie-infected sheep and 10 normal sheep were obtained
148 from Dr. Katherine ORorke, USDA, Pullman, WAAll. Six
149 frozen CWD-infected cervid brain samples and one lym-
150 phoid tissue sample from a CWD-infected elk were obtained
151 from Dr. Terry Spraker, Colorado State University. Seven
152 additional frozen normal cervid brains were obtained from a
153 Mobile, AL hunting lodge and used as controls for the
154 cervid study. The CJD-, scrapie-, and CWD-infected cases
155 had been studied by immunocytochemistry using Prion-
156 specific monoclonal antibodies. All tissue samples were
157 stored at 80jC.
158
159 Extraction of DNA
160 DNA was extracted from TSE-infected and normal
161 brain tissues and lymphoid tissues using a modified
162 guanidine thiocyanate DNA extraction method (Casas et
163 al., 1995) followed by phenol/chloroform. Briefly, 20 mg
164 of each individual tissue sample was minced with a sterile
165 scalpel and placed in a tissue homogenizer with 250 Al of
166 lysis buffer [GuSCN 9.4 g; dH2O 16 ml; 20% N-lauryl-
F.O. Bastian et al. / Experimental and Molecular Pathology xx (2004)
xxxxxx 2
UNCORRECTED PROOF
ARTICLE IN PRESS
167 sarcasine 500 Al; 1.5 M NaCl in 0.5 M Tris buffer (pH
168 7.4) 4 ml; 1 M dithiothreitol (DTT) 20 Al]. The tissue
169 specimens were ground thoroughly with a pestle then
170 incubated at 37jC for 30 min, followed by an incubation
171 at 65jC for 30 min. The preparation was centrifuged for
172 20 min at 14,000 g (4jC). The liquid was decanted to a
173 new tube, the pellet discarded, 500 Al of phenol/chloro-
174 form/isoamyl alcohol (25/24/1) was added, and the prep-
175 aration was mixed, then centrifuged for 5 min at 14,000
176 g (4jC). The upper aqueous sample was removed and
177 placed in a new tube. A second phenol extraction was
178 done followed by centrifugation (see above). Five hundred
179 microliters of chloroform/isoamyl alcohol (25/1) was
180 added to the aqueous sample, and the mixture was centri-
181 fuged for 5 min at 14,000 g (4jC). The upper aqueous
182 sample was removed, placed in new tube, and 500 Al of
183 cold 100% ethanol was added. The preparation was
184 incubated for 30 min at 80jC, then centrifuged for 10
185 min at 14,000 g (4jC). The liquid was decanted and the
186 pellet resuspended in 500 Al of 70% ethanol. The prepa-
187 ration was centrifuged for 30 min at 14,000 g (4jC),
188 and the liquid was decanted. The tube was inverted and the
189 pellet was allowed to dry for 5 min. The pellet was then
190 dissolved in 50 Al distilled ultra pure H2O and stored at
191 20jC. The DNA concentration was measured by spec-
192 trophotometer at 260 nm.
193
194 Amplification of Spiroplasma ribosomal DNA
195 Three separate polymerase chain reaction (PCR) analyses
196 were carried out on the TSE samples available to the
197 laboratory.
198 The first series of experiments involved PCR analyses
199 of 10 scrapie-infected sheep brains and 10 normal sheep
200 brains where the diagnoses had been made by the USDA
201 using immunocytochemistry and monoclonal antibodies
202 specific for sheep prion. We used oligo primers for the
203 sheep h-actin gene to determine the integrity of the DNA
204 samples (Table 1).
205 The second series of experiments involved PCR analyses
206 of seven CWD-infected cervid samples. All had been
207 evaluated for the presence of prion protein by investigators
208 at Colorado State University using immunocytochemistry
209 and monoclonal antibodies specific for cervid prion. The
210 integrity of the DNA samples extracted from the CWD-
211 infected animals and the control cervid brains was evaluated
212 by PCR amplification using oligo primers for cervid normal
213 prion gene (Table 1).
214 The third involved a sampling of two CJD cases which
215 had been evaluated for presence of prion protein by the
216 Prion Surveillance laboratory at Case Western Reserve,
217 Cleveland, OH. The integrity of the DNA samples extracted
218 from these cases and two age-matched controls was evalu-
219 ated by PCR amplification using oligo primers for human h-
220 globin gene (Table 1).
221 All PCR studies were carried out in a laboratory
222 physically separate from the laboratory where the DNA
223 extractions took place. The Spiroplasma-specific 16S
224 rDNA primers were essentially identical to those previ-
225 ously published except for extension of the forward
226 primer downstream by seven bases (Bastian and Foster,
227 2001). The primers used in this study are forward oligo
228 F28 and reverse oligo R5 (Table 1). Briefly, 200 ng of
229 DNA sample was used for each reaction. All PCR
230 reactions were carried out using an iCycler (BIO-RAD).
231 The PCR reaction mix for each sample included 5 Al of
232 10X buffer, 3.5 Al of 25 mM MgCl2, 1 Al of 10 mM
233 dNTP, 1 Al of forward primer (250 ng/Al), 1 Al of reverse
234 primer (250 ng/Al), 200 ng of the DNA sample, 2.5 u
235 (0.5 Al) of Taq DNA polymerase, and ultra pure H2O to
236 a final volume of 50 Al. The sample was denatured at
237 95jC for 4 min then underwent 3 cycles of 95jC (30 s),
238 59jC (1 min), and 72jC (2 min) followed by 32 cycles
239 of 95jC (30 s), 56jC (1 min), and 72jC (2 min) with an
t1.1 Table 1
Oligonucleotide sequences of primers and probes used in polymerase chain
reaction and southern blot analyses t1.2
Oligomer sequence Product size t1.3
Probe for Spiroplasma 16S rDNA PCR/Southern blot t1.4
[F28 sense primer] 5V-CGCAGACGGTTT AGCAAGTTTGGG-3V t1.5
[R5 antisense primer] 5V-AGCACCGAACTTAGTCCGACAC-3V t1.6
[Antisense oligonucleotide probe]
5V-GCCTTCGCCACTGGTGTTCCTCCATATATCTACGCATTC-3V 270 bp t1.7
Human h-globin PCR/Southern blot t1.8
[Sense primer] 5V-GGGGAATTCCAACTTCATCCCACGTTT-3V t1.9
[Antisense primer] 5V-GGGGAATTCGAAGAGCCAAGGACAGG-3V t1.10
[Antisense oligonucleotide probe] 5V-GACACCATGGTGCACCTGACT-3V 268 bp t1.11
Sheep h-actin PCR/Southern blot t1.12
[Forward primer] 5V-TGGGACGACATGGAGAAGATCTG-3V t1.13
[Antisense primer] 5V-CAGCACAGCCTGGATGGCCACGTAC-3V t1.14
[Antisense oligonucleotide probe]
5V-CATGATCTGGGTCATCTTCTCACGGTTGGCCTTGGGGTTC-3V 186 bp t1.15
Cervid prion PCR/Southern blot t1.16
[Sense primer] 5V-CACCACCAAGGGGGAGAACTTCACCGAAAC-3V t1.17
[Antisense primer] 5V-ATGAGAAAAATGAGGAAAGAGATGAGGAGG-3V t1.18
[Antisense oligonucleotide probe]
5V-CCTCTTTGGTAATAAGCCTGGGATTCTCTCTGGTACTGGG-3V 180 bp t1.19
F.O. Bastian et al. / Experimental and Molecular Pathology xx (2004)
xxxxxx 3
UNCORRECTED PROOF
ARTICLE IN PRESS
240 extension cycle at 72jC (4 min). For each PCR reaction,
241 water (no DNA template) was used as a reagent control.
242
243 Southern blot analyses
244 Specificity of the PCR products was studied by South-
245 ern blotting using an oligonucleotide probe specific for
246 expected PCR product in each instance. All TSE PCR-
247 derived samples were probed with the primers specific for
248 Spiroplasma 16S rDNA and were subjected to Southern
249 blot using a 40-base pair (bp) antisense oligo in the center
250 of the predicted sequence of Spiroplasma ribosomal DNA
251 (Table 1). The probe was tested by blast analysis and
252 matched with Spiroplasma sp., particularly, Spiroplasma
253 mirum. Similarly, for each individual TSE sample exam-
254 ined, the PCR product of the house-keeping genes used to
255 evaluate the integrity of the DNA was probed with the
256 appropriate 40-bp antisense oligo probe. For human CJD
257 and normal brain, a globin-specific oligo probe was used
258 (Table 1). For the scrapie-infected and normal sheep
259 brains, we probed using an oligo probe specific for the
260 h-actin gene of sheep. For cervid samples, we used an
261 oligo probe specific for the PCR product generated by the
262 cervid prion gene primers (Table 1).
263 Briefly, the PCR products generated with the Spiro-
264 plasma-specific 16S rDNA primers or the housekeeping
265 genes were electrophoresed on 1% agarose, transferred into
266 a Zeta probe nylon membrane, and hybridized using a P32-
267 labeled antisense oligonucleotide probe specific for the
268 appropriate gene (Table 1). All experiments were repeated
269 at least three times starting from DNA extraction to South-
270 ern blot analysis.
271
272 DNA sequence analyses
273 The PCR products from the two CJD-positive cases, five
274 of the scrapie-infected sheep brain PCR-positive cases, and
275 five of the CWD-infected cervid brains were cloned in
Fig. 1. Southern blot analyses of scrapie-infected and normal sheep
brains probed for Spiroplasma 16S rDNA. (A) Individual scrapie-infected
(10) and normal
sheep brains (10) probed with P32-labeled Spiroplasma ribosomal oligo
reverse primer. (Lane 1) Spiroplasma control, (Lane 2) PCR control,
(Lanes 3 to 12) 10
scrapie-infected sheep brains, (Lane 13) empty, (Lane 14) Spiroplasma
control, (Lane 15) PCR control, and (Lanes 16 to 25) 10 normal sheep
brains. Eight of
the ten scrapie-infected sheep brains (Lanes 5 to 12) show presence of
Spiroplasma ribosomal DNA, while all control normal sheep brains are
negative. (B)
Southern blot of corresponding sheep brain samples with oligo antisense
probe for h-actin to show integrity of DNA. All 20 sheep brain samples
are positive
for h-actin.
Fig. 2. Southern blot of CWD-infected and normal cervid brains and one
lymphoid tissue sample from a CWD-infected elk probed for Spiroplasma
16S rDNA.
(A) Individual CWD-infected cervid brains (6), CWD-infected lymphoid
tissue (1), and normal cervid brains (7) probed with P32-labeled Spiroplasma
ribosomal oligo reverse primer. (Lane 1) Spiroplasma control, (Lane 2)
empty, (Lanes 3 and 5 to 9) six CWD-infected cervid brains, (Lane 4)
lymphoid tissue
sample from CWD-infected elk, (Lanes 10 and 12) empty, (Lane 11) PCR
control, (Lane 13) Spiroplasma control, (Lane 14) empty, (Lanes 15 to
21), seven
normal cervid brains, (Lanes 22 and 24) empty, and (Lane 23) PCR
control. Five of the six CWD-infected cervid brains (Lanes 3 and 6 to
12) show presence of
Spiroplasma ribosomal DNA, while all control normal cervid brains are
negative. The lymphoid tissue sample from CWD-infected elk (Lane 4) is
strongly
positive for Spiroplasma 16S rDNA. (B) Southern blot of corresponding
cervid brain and lymphoid samples with oligo antisense probe for cervid
prion gene to
show integrity of DNA. All cervid tissue samples are positive for prion
gene.
F.O. Bastian et al. / Experimental and Molecular Pathology xx (2004)
xxxxxx 4
UNCORRECTED PROOF
ARTICLE IN PRESS
276 pCRRII plasmid (Invitrogen Life Technologies) and then
277 sequenced (ABI DNA sequencer).
278 Results
279 This study is in follow-up of our previous work wherein
280 we had demonstrated Spiroplasma-specific 16S rDNA by
281 PCR and DNA sequence analyses in a limited number of
282 CJD brains and scrapie-infected sheep brains. We have
283 reproduced these data in this study in a somewhat larger
284 sampling of TSE samples including CWD. Furthermore, in
285 this study, we used methodology that demonstrated more
286 sensitivity and more specificity of the PCR reactions, which
287 involved the use of Southern blotting in combination with
288 cloning and sequence analyses. Southern blotting of PCR
289 products from scrapie-infected and control samples, as
290 shown in Fig. 1A, has revealed 8 of 10 scrapie-infected
291 sheep brains to be positive, while all control normal sheep
292 brains were negative. Fig. 1B shows corresponding South-
293 ern blot for h-actin gene in all sheep brain samples,
294 demonstrating adequate DNA loading. Southern blotting
295 of seven CWD-infected tissue samples revealed five of the
296 CWD-infected brains and the lymphoid tissue derived from
297 the CWD-infected elk to be positive, as shown in Fig. 2A.
298 Fig. 2B shows corresponding Southern blot of prion gene in
299 all cervid samples indicating adequate DNA loading. South-
300 ern blotting of PCR products from two CJD-infected and
301 two control samples, as shown in Fig. 3A, has revealed both
302 of the CJD-infected human cases to be positive, while the
303 two normal human brains are negative. Fig. 3B shows
304 corresponding Southern blot for h-globin gene in all human
305 brain samples, demonstrating adequate DNA loading. The
306 PCR results of the Spiroplasma gene probes were compared
307 with the prion positivity in the specimen studies as shown in
308 Table 2.
309 In DNA sequence analyses performed on PCR products
310 obtained from the scrapie CWD and CJD cases revealed a
311 striking 99% homology with published S. mirum 16S rDNA
Fig. 3. Southern blot analyses of CJD-infected and normal human brain
probed for Spiroplasma 16S rDNA. (A) Individual CJD-infected brains
and normal human brains probed with P32-labeled Spiroplasma ribosomal
oligo reverse primer. (Lane 1) Spiroplasma control, (Lanes 2 to 3) two
normal human brains, (Lanes 4 to 5) two CJD-infected brains, and (Lane
6) PCR control. Both of the CJD-infected brains show presence of
Spiroplasma ribosomal DNA, while two control normal human brains are
negative. (B) Southern blot of corresponding brain samples with oligo
antisense probe for h-globin to show integrity of DNA. (Lane 1)
Spiroplasma control, (Lanes 2 to 5) normal, and CJD-infected brains. All
brain samples are positive for h-globin.
t2.1 Table 2
Correlation of Southern blot for detection of Spiroplasma 16S rDNA with
presence of prion protein in TSE samples t2.2
Samples Prion immune positive Spiroplasma 16S rDNA h-globin h-actin
Prion gene t2.3
TEST_Probe
(for determination of adequate sample loading) t2.4
Scrapie-infected sheep t2.5
Case 1 + + t2.6
Case 2 + + t2.7
Case 3 + + + t2.8
Case 4 + + + t2.9
Case 5 + + + t2.10
Case 6 + + + t2.11
Case 7 + + + t2.12
Case 8 + + + t2.13
Case 9 + + + t2.14
Case 10 + + + t2.15
CWD-infected cervids t2.16
Case 1 + + + t2.17
Case 2 (lymphoid tissues) + + + t2.18
Case 3 + + t2.19
Case 4 + + + t2.20
Case 5 + + + t2.21
Case 6 + + + t2.22
Case 7 + + + t2.23
Creutzfeldt-Jakob disease (human) t2.24
Case 1 + + + t2.25
Case 2 + + + t2.26
F.O. Bastian et al. / Experimental and Molecular Pathology xx (2004)
xxxxxx 5
UNCORRECTED PROOF
ARTICLE IN PRESS
t3.1 Table 3
DNA sequence analyses of clones of PCR products from scrapie cases
compared to Spiroplasma mirum 16S rDNA sequence t3.2
592 612 632 652 672 t3.3
Spiroplasma mirum.GenBk 573 CGCAGACGGTTTAGCAAGTT TGGGGTTAAAGACTGGGGCT
CAACTCCAGTTCGCCTTGAA AACTGTTAGACTAGAGTGTA GGAGAGGTTGATGGAATTCC t3.4
Scrapie CLONE.case #3 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ t3.5
Scrapie CLONE.case #4 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ t3.6
Scrapie CLONE.case #5 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ t3.7
Scrapie CLONE.case #8 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ t3.8
Scrapie CLONE.case #10 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ t3.9
t3.10
692 712 732 752 772 t3.11
Spiroplasma mirum.GenBk 673 ATGTGTAGCGGTGAAATGCG TAGATATATGGAGGAACACC
AGTGGCGAAGGCGGTCAACT GGCCTATCACTGACGTTTAG GCACGAAAGCGTGGGGAGCA t3.12
Scrapie CLONE.case #3 673 _ _ A _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ t3.13
Scrapie CLONE.case #4 673 _ _ A _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ t3.14
Scrapie CLONE.case #5 673 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ T _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ t3.15
Scrapie CLONE.case #8 673 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ T _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ t3.16
Scrapie CLONE.case #10 673 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ T _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ t3.17
t3.18
792 812 832 852 t3.19
Spiroplasma mirum.GenBk 773 AATAGGATTAGATACCCTAG TAGTCCACGCCGTAAACGAT
GAGTACTAAGTGTCGGACTA AGTTCGGTGC t3.20
Scrapie CLONE.case #3 773 _ _ _ G _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ t3.21
Scrapie CLONE.case #4 773 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ t3.22
Scrapie CLONE.case #5 773 _ _ _ _ _ _ _ G _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ t3.23
Scrapie CLONE.case #8 773 _ _ _ _ _ _ _ G _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ t3.24
Scrapie CLONE.case #10 773 _ _ _ _ _ _ _ G _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ t3.25
t4.1 Table 4
DNA sequence analyses of clones of PCR products from CWD cases compared
to Spiroplasma mirum 16S rDNA sequence t4.2
592 612 632 652 672 t4.3
Spiroplasma mirum.GenBk 573 CGCAGACGGTTTAGCAAGTT TGGGGTTAAAGACTGGGGCT
CAACTCCAGTTCGCCTTGAA AACTGTTAGACTAGAGTGTA GGAGAGGTTGATGGAATTCC t4.4
CWD Clone Case #1 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t4.5
CWD Clone Case #2 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t4.6
CWD Clone Case #4 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t4.7
CWD Clone Case #5 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t4.8
CWD Clone Case #6 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t4.9
t4.10
692 712 732 752 772 t4.11
Spiroplasma mirum.GenBk 673 ATGTGTAGCGGTGAAATGCG TAGATATATGGAGGAACACC
AGTGGCGAAGGCGGTCAACT GGCCTATCACTGACGTTTAG GCACGAAAGCGTGGGGAGCA t4.12
CWD Clone Case #1 673 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ T _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t4.13
CWD Clone Case #2 673 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ T _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t4.14
CWD Clone Case #4 673 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ T _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t4.15
CWD Clone Case #5 673 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ T _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t4.16
CWD Clone Case #6 673 _ _ _ _ _ _ _ _ _ _ _ C _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ T _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t4.17
t4.18
792 812 832 852 t4.19
Spiroplasma mirum.GenBk 773 AATAGGATTAGATACCCTAG TAGTCCACGCCGTAAACGAT
GAGTACTAAGTGTCGGACTA AGTTCGGTGC t4.20
CWD Clone Case #1 773 _ _ _ _ _ _ G _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ t4.21
CWD Clone Case #2 773 _ _ _ _ _ _ G _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ t4.22
CWD Clone Case #4 773 _ _ _ _ _ _ G _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ t4.23
CWD Clone Case #5 773 _ _ _ _ _ _ G _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ t4.24
CWD Clone Case #6 773 _ _ _ _ _ _ G C _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ t4.25
F.O. Bastian et al. / Experimental and Molecular Pathology xx (2004)
xxxxxx 6
UNCORRECTED PROOF
ARTICLE IN PRESS
312 sequences (M24662). The TSE-derived sequences are com-
313 pared in Tables 35. In Table 3, the five scrapie clones
314 sequenced showed significant homology with S. mirum but
315 with two different patterns. Scrapie clones from cases 3 and
316 4 revealed differences at position 675 with G to A and at
317 position 716 with G to A. Scrapie clone 3, in addition,
318 showed a difference at position 776 with A to G. Scrapie
319 clones from cases 5, 8, and 10 showed a very different
320 pattern with A to T seen at position 729 and A to G at
321 position 779. These two patterns in oligonucleotide vari-
322 ability in the different scrapie samples suggest at least two
323 strain differences. The CWD differences noted on sequenc-
324 ing in Table 4 produced a rather uniform pattern among the
325 five clones sequenced. All CWD clones showed A to T
326 difference at position 729 and A to G at position 779. CWD
327 clone 6 showed a T to C difference at positions 684 and 780.
328 It is noteworthy that the CWD clone sequence differences
329 closely resembled the pattern of scrapie clones 5, 8, and 10
330 as shown in Table 3, suggesting a possible relationship with
331 that scrapie strain. The two CJD clones in Table 5 showed a
332 very close homology with the S. mirum GenBank sequence.
333 In both CJD clones, there is an A to G difference at position
334 779. CJD clone 2 showed an additional difference with A to
335 G at position 696. The scrapie and CWD clones did not
336 resemble the CJD clones, suggesting that they were unre-
337 lated to the human TSE strain. All TSE-derived sequences
338 in this study showed high similarity to S. mirum sequences
339 in the GenBank.
340 Conclusion
341 This study validates our previously reported data show-
342 ing the presence of Spiroplasma ribosomal DNA in CJD-
343 and scrapie-infected brain tissues (Bastian and Foster,
344 2001). We carried out these experiments in a new laboratory
345 on a new set of samples using a newly designed set of
346 oligonucleotide primers (see Table 1). As the study pro-
347 gressed, we found that the mode of DNA extraction was
348 important in showing the target 270-bp PCR product. We
349 found that the most reliable method involved initial solubi-
350 lization with guanidine thiocyanate followed by phenol/
351 chloroform extraction. It is noteworthy that Qiagen kit we
352 used in our previously reported study (Bastian and Foster,
353 2001) incorporates a guanidine solubilization protocol be-
354 fore their proteinase K treatment. Infectivity of the samples
355 is effectively destroyed by guanidine treatment (Manuelidis,
356 1997), therein providing a safe work environment. Our
357 strategy was to increase the specificity and sensitivity of
358 the probe by utilization of PCR followed by Southern
359 blotting and DNA sequence analyses. Southern blotting
360 was clearly more sensitive than PCR alone and detected
361 Spiroplasma DNA in samples where the PCR product was
362 not readily apparent (data not shown). The PCR conditions
363 used in this study were less stringent than those used in the
364 prior study (Bastian and Foster, 2001) and produced several
t5.1 Table 5
DNA sequence analyses of clones of PCR products from CJD cases compared
to Spiroplasma mirum 16S rDNA sequence t5.2
592 612 632 652 672 t5.3
Spiroplasma mirum.GenBk 573 CGCAGACGGTTTAGCAAGTT TGGGGTTAAAGACTGGGGCT
CAACTCCAGTTCGCCTTGAA AACTGTTAGACTAGAGTGTA GGAGAGGTTGATGGAATTCC t5.4
CJD CLONE.case #1 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t5.5
CJD CLONE.case #2 573 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t5.6
t5.7
692 712 732 752 772 t5.8
Spiroplasma mirum.GenBk 673 ATGTGTAGCGGTGAAATGCG TAGATATATGGAGGAACACC
AGTGGCGAAGGCGGTCAACT GGCCTATCACTGACGTTTG GCACGAAAGCGTGGGGAGCA t5.9
CJD CLONE.case #1 673 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t5.10
CJD CLONE.case #2 673 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ G _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ t5.11
t5.12
792 812 832 852 t5.13
Spiroplasma mirum.GenBk 773 AATAGGATTAGATACCCTAG TAGTCCACGCCGTAAACGAT
GAGTACTAAGTGTCGGACTA AGTTCGGTGC t5.14
CJD CLONE.case #1 773 _ _ _ _ _ _ G _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ t5.15
CJD CLONE.case #2 773 _ _ _ _ _ _ G _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ t5.16
F.O. Bastian et al. / Experimental and Molecular Pathology xx (2004)
xxxxxx 7
UNCORRECTED PROOF
ARTICLE IN PRESS
365 PCR bands utilizing these primers (data not shown). How-
366 ever, Southern blotting with an oligonucleotide probe was
367 effective in identifying only a single specific PCR product.
368 That PCR product when examined by DNA sequence
369 analysis was found to show 99% homology with the S.
370 mirum 16S rDNA sequence available in the GenBank.
371 Using these procedures, Spiroplasma ribosomal DNA was
372 found in all forms of TSE available to our laboratory,
373 including CJD in human brain, scrapie in sheep brain, and
374 CWD in cervid brain.
375 Although DNA sequence analyses of two CJD cases, five
376 individual scrapie clones, and five CWD clones showed
377 significant homology with the GenBank sequence of S.
378 mirum 16S rDNA, there were minor differences suggesting
379 different strains of Spiroplasma involved. Two different
380 sequence patterns were noted in the five scrapie samples
381 examined indicating presence of two individual strains. The
382 cervid samples showed commonality with all five sequences
383 and suggested involvement of a single CWD strain. The
384 sequence pattern in CWD closely resembled one of the
385 scrapie strains suggesting a link of CWD to scrapie. The
386 Spiroplasma ribosomal sequences in the two CJD cases
387 differed from both animal forms of TSE, suggesting that a
388 different strain of Spiroplasma was present in the human
389 cases.
390 These data clearly show that Spiroplasma infection is
391 associated with TSE, which raises the question of the role of
392 Spiroplasma in the pathogenesis of TSE. Our findings fit
393 with the new revelation regarding evidence that the host
394 prion protein acts as a facilitator of the disease, serving as a
395 receptor through its interaction with an infectious organism
396 (Watarai et al., 2003). Our concept that Spiroplasma is
397 involved in the pathogenesis of TSE is supported by studies
398 of experimental scrapie infection in mice where infection is
399 prevented by tetracycline therapy (Forloni et al., 2002).
400 Furthermore, the prion alone does not fully explain the
401 etiopathology of TSE (Kaneko et al., 1997). We plan to test
402 our hypothesis in the future by establishing experimental
403 Spiroplasma infection in mice lacking the prion gene
404 (Telling, 2000) which would show that Spiroplasma infec-
405 tion is dependent upon interaction with prion membrane
406 protein. In addition, in this study, we were able to determine
407 minor sequence variations of Spiroplasma ribosomal DNA
408 in individual TSE cases suggesting involvement of different
409 strains of Spiroplasma in TSE. It will be important to
410 examine many more TSE samples to determine if sequence
411 analyses of PCR products detected by our ribosomal probe
412 will be useful in linking individual TSE cases. Our sequence
413 data have clearly suggested relatedness between CWD cases
414 and several of the scrapie samples, implying that the CWD
415 epidemic may have originated from scrapie infection.
416 Uncited reference
417 Bruce, 1993
418 Acknowledgments
419 We thank Dr. Gail Gasparich, Towson University,
420 Baltimore, MD, for the Spiroplasma mirum [suckling
421 mouse cataract agent (SMCA)] DNA, Dr. Katherine
422 ORorke, USDA, Pullman, WA, for the scrapie-infected
423 and normal sheep brain samples, and Dr. Larry Spraker,
424 Colorado State University, for the CWD-infected cervid
425 tissues. The project was funded by NIH grant # R01-
426 NS044000.
427 References
428 Bastian, F.O., 1979. Spiroplasma-like inclusions in
Creutzfeldt-Jakob dis-
429 ease. Arch. Pathol. Lab. Med. 103, 665669.
430 Bastian, F.O., 1991. Review of theories on the nature of the
transmissible
431 agent. In: Bastian, F.O. (Ed.), Creutzfeldt-Jakob Disease and Other
432 Transmissible Spongiform Encephalopathies. Mosby/Year Book, St.
433 Louis, pp. 49 64.
434 Bastian, F.O., Foster, J.W., 2001. Spiroplasma sp. 16S rDNA in Creutz-
435 feldt-Jakob disease and scrapie as shown by PCR and DNA sequence
436 analysis. J. Neuropathol. Exp. Neurol. 60, 613 620.
437 Bastian, F.O., Hart, M.N., Cancila, P.A., 1980. Additional evidence of
438 Spiroplasma in Creutzfeldt-Jakob disease. Lancet 1, 660.
439 Bastian, F.O., Purnell, D.M., Tully, J.G., 1984. Neuropathology of
Spiro-
440 plasma infection in the rat brain. Am. J. Pathol. 114, 496 514.
441 Bastian, F.O., Jennings, R.A., Gardner, W.A., 1987a. Antiserum to
scrapie-
442 associated fibril protein cross-reacts with Spiroplasma mirum fibril
pro-
443 tein. J. Clin. Microbiol. 25, 24302431.
444 Bastian, F.O., Jennings, R.A., Hoff, C.J., 1987b. Neurotropic
response of
445 Spiroplasma mirum following peripheral inoculation in the rat. Ann.
446 Microbiol. Pasteur. 138, 651 655.
447 Belay, E.D., Gambetti, P., Schonberger, L.B., Parchi, P., Lyon,
D.R., Capel-
448 lari, S., McQuiston, H., Bradely, K., Dowdel, G., Crutcher, J.M., Nich-
449 ols, C.R., 2001. Creutzfeldt-Jakob disease in unusually young patients
450 who consumed venison. Arch. Neurol. 58, 1673 1678.
451 Besnoit, C., 1899. La tremblante ou ne´vrite pe´riphe´rique
enzootique du
452 mouton. Rev. Vet. Toulouse 24, 265 343.
453 Bessen, R.A., Marsh, R.F., 1992. Biochemical and physical properties of
454 the prion protein from two strains of the transmissible mink encepha-
455 lopathy agent. J. Virol. 66, 2096 2101.
456 Bessen, R.A., Marsh, R.F., 1994. Distinct PrP properties suggest the mo-
457 lecular basis of strain variation in transmissible mink encephalopathy.
458 J. Virol. 68, 7859 7868.
459 Brown, P., Cathala, F., Raubertas, R.F., Gajdusek, D.C., Castaigne, P.,
460 1987. The epidemiology of Creutzfeldt-Jakob disease: conclusion of a
461 15-year investigation in France and review of the world literature. Neu-
462 rology 37, 895904.
463 Bruce, M.E., 1993. Scrapie strain variation and mutation. Br. Med. Bull.
464 49, 822 838.
465 Bruce, M.E., Chree, A., McConnell, I., Fraser, J., Pearson, G.,
Fraser, H.,
466 1994. Transmission of bovine spongiform encephalopathy and scrapie
467 to mice: strain variation and the species barrier. Philos. Trans. R.
Soc.
468 London, Ser. B 343, 405 411.
469 Bruce, M.E., Boyle, A., Cousens, S., McConnell, I., Fraser, J.,
Goldmann,
470 W., Fraser, H., 2002. Strain characterization of natural sheep
scrapie and
471 comparison with BSE. J. Gen. Virol. 83, 695 704.
472 Casalone, C., Zanusso, G., Acutis, P., Ferrari, S., Capucci, L., Taglia-
473 vini, F., Monaco, S., Caramelli, M., 2004. Identification of a second
474 bovine amyloidotic spongiform encephalopathy: molecular similari-
475 ties with sporadic Creutzfeldt-Jakob disease. Proc. Natl. Acad. Sci.,
476 16.
477 Casas, I., Powell, P.E., Cleator, G.M., 1995. New method for the
extraction
F.O. Bastian et al. / Experimental and Molecular Pathology xx (2004)
xxxxxx 8
UNCORRECTED PROOF
ARTICLE IN PRESS
478 of viral RNA and DNA from cerebrospinal fluid for use in the poly-
479 merase chain reaction assay. J. Virol. Methods 53, 25 36.
480 Forloni, G., Iussich, S., Awan, T., Colombo, L., Angeretti, N., Girola,
481 L., Bertani, I., Poli, G., Caramelli, M., Grazia Bruzzone, M., Garina,
482 L., Limido, L., Rossi, G., Giaccone, G., Ironside, J.W., Bugiani, O.,
483 Salmona, M., Tagliavini, F., 2002. Tetracyclines affect prion infec-
484 tivity. Proc. Natl. Acad. Sci. U. S. A. 99, 1084910854.
485 Foster, J., Goldmann,W., Parnham, D., Chong, A., Hunter, N., 2001.
Partial
486 dissociation of PrP(Sc) deposition and vacuolation in the brains of
scrapie
487 and BSE experimentally affected goats. J. Gen. Virol. 82, 267273.
488 Hamir, A.N., Cutlip, R.C., Miller, J.M., Williams, E.S., Stack,
M.J., Miller,
489 M.W., ORourke, K.I., Chaplin, M.J., 2001. Preliminary findings on the
490 experimental transmission of chronic wasting disease agent of mule
491 deer to cattle. J. Vet. Diagn. Invest. 13, 91 96.
492 Hill, A.F., Desbruslais, M., Joiner, S., Sidle, K.C.L., Gowland, I.,
Collinge,
493 J., 1997. The same prion strain causes vCJD and BSE. Nature 389,
494 448450.
495 Ironside, J.W., 1996. Neuropathological diagnosis of human prion
disease:
496 morphological studies. In: Baker, H.F., Ridley, R.M. (Eds.), Prion Dis-
497 eases. Humana Press, Totowa, NJ, pp. 35 58.
498 Kaneko, K., Zulianello, L., Scott, M., Cooper, C.M., Wallace, A.C.,
James,
499 T.L., Cohen, F.E., Prusiner, S.B., 1997. Evidence for protein X binding
500 to a discontinuous epitope on the cellular prion protein during scrapie
501 propagation. Proc. Natl. Acad. Sci. 94, 10069 10074.
502 Kovacs, G.G., Head, M.W., Hegyi, I., Bunn, T.J., Flicker, H.,
Hainfellner,
503 J.A., McCardle, L., Laszlo, L., Jarius, C., Ironside, J.W., Budka, H.,
504 2002. Immunohistochemistry for the prion protein: comparison of
505 different monoclonal antibodies in human prion disease subtypes.
506 Brain Pathol. 12, 1 11.
507 Liberski, P.P., Guiroy, D.C., Williams, E.S., Walis, A., Budka, H.,
2001.
508 Deposition patterns of disease-associated prion protein in captive mule
509 deer brains with chronic wasting disease. Acta Neuropathol. 102,
510 496500.
511 Manuelidis, L., 1997. Decontamination of Creutzfeldt-Jakob disease and
512 other transmissible agents. J. Neurovirol. 3, 6265.
513 Manuelidis, L., Fritch, W., Xi, Y.G., 1997. Evolution of a strain of
CJD that
514 induces BSE-like plaques. Science 277, 94 98.
515 Nathanson, N., Wilesmith, J., Griot, C., 1997. Bovine spongiform enceph-
516 alopathy: causes and consequences of a common source epidemic. Am.
517 J. Epidemiol. 145, 959 969.
518 Petersen, R.B., 1999. Antemortem diagnosis of variant Creutzfeldt-Jakob
519 disease. Lancet 353, 163164.
520 Race, R., Raines, A., Raymond, G.J., Caughy, B., Chesebro, B., 2001.
521 Long-term subclinical carrier state precedes scrapie replication and ad-
522 aptation in a resistant species: analogies to bovine spongiform enceph-
523 alopathy and variant Creutzfeldt-Jakob disease in humans. J. Virol. 75,
524 10106 10111.
525 Race, R.E., Raines, A., Baron, T.G., Miller, M.W., Jenny, A., Williams,
526 E.S., 2002. Comparison of abnormal prion protein glycoform patterns
527 from transmissible spongiform encephalopathy agent-infected deer, elk,
528 sheep and cattle. J. Virol. 76, 1236512368.
529 Safar, J., Cohen, F.E., Prusiner, S.B., 2000. Quantitative traits of
prion
530 strains are enciphered in the conformation of the prion protein. Arch.
531 Virol. (Suppl.) 16, 227235.
532 Spraker, T.R., Miller, M.W., Willams, E.S., Getzy, D.M., Adrian, W.J.,
533 Schoonveld, G.G., Spowart, R.A., ORourke, K.I., Miller, J.M., Merz,
534 P.A., 1997. Spongiform encephalopathy in free-ranging mule deer
535 (Odocoileus hemionus), white-tailed deer (Odocoileus virginianus)
536 and Rocky Mountain Elk (Cervus elaphus nelsoni) in north central
537 Colorado. J. Wildl. Dis. 33, 1 6.
538 Telling, G.C., 2000. Prion protein genes and prion diseases: studies in
539 transgenic mice. Neuropathol. Appl. Neurobiol. 26, 209 220.
540 Watarai, M., Kim, S., Erdenebaatar, J., Makino, S.-I., Horiuchi, M.,
541 Shirahata, T., Sakaguchi, S., Katamine, S., 2003. Cellular prion pro-
542 tein promotes Brucella infection into macrophages. J. Exp. Med.
543 198, 5 17.
544 Will, R.G., Ironside, J.W., Zeidler, M., Cousens, S.N., Estibeiro, K.,
545 Alperovitch, A., Poser, S., Pocchiari, M., Hofman, A., Smith, P.G.,
546 1996. A new variant of Creutzfeldt-Jakob disease in the UK. Lancet
547 347, 921925.
548
F.O. Bastian et al. / Experimental and Molecular Pathology xx (2004)
xxxxxx 9 TSS ######### http://mailhost-alt.rz.uni-karlsruhe.de/warc/bse-l.html ##########
Follow Ups:
Post a Followup
|
