SEARCH VEGSOURCE:

 

 

Follow Ups | Post Followup | Back to Discussion Board | VegSource
See spam or
inappropriate posts?
Please let us know.
  




From: TSS ()
Subject: CWD OF ELK: TRANSMISSIBILITY TO HUMANS EXAMINED BY TRANSGENIC MOUSE MODELS (FULL TEXT)
Date: October 3, 2005 at 10:31 am PST

Neurobiology of Disease

Chronic Wasting Disease of Elk: Transmissibility to Humans

Examined by Transgenic Mouse Models

Qingzhong Kong,1 Shenghai Huang,1 Wenquan Zou,1 Difernando Vanegas,1 Meiling Wang,1 Di Wu,1 Jue Yuan,1

Mengjie Zheng,1 Hua Bai,1 Huayun Deng,2 Ken Chen,3 Allen L. Jenny,4 Katherine O’Rourke,5 Ermias D. Belay,6

Lawrence B. Schonberger,6 Robert B. Petersen,1 Man-Sun Sy,1 Shu G. Chen,1 and Pierluigi Gambetti1

Departments of 1Pathology and 2Pharmacology, Case Western Reserve University, Cleveland, Ohio 44106, 3Department of Developmental and Molecular

Biology, Albert Einstein College of Medicine, Bronx, New York 10461, 4National Veterinary Services Laboratories, United States Department of Agriculture,

Ames, Iowa 50010, 5Animal Disease Research Unit, Agricultural Research Service, United States Department of Agriculture, Pullman, Washington 99164,

and 6Division of Viral and Rickettsial Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia 30333

Chronic wasting disease (CWD), a prion disease affecting free-ranging and captive cervids (deer and elk), is widespread in the United

States and parts of Canada. The large cervid population, the popularity of venison consumption, and the apparent spread of the CWD

epidemic are likely resulting in increased human exposure toCWDin the United States. WhetherCWDis transmissible to humans, as has

been shown for bovine spongiform encephalopathy (the prion disease of cattle), is unknown. We generated transgenic mice expressing

the elk or human prion protein (PrP) in a PrP-null background. After intracerebral inoculation with elk CWD prion, two lines of

"humanized" transgenic mice that are susceptible tohumanprions failed to develop the hallmarks of prion diseases after657 and756

d, respectively, whereas the "cervidized" transgenic mice became infected after 118 –142 d. These data indicate that there is a substantial

species barrier for transmission of elk CWD to humans.

Key words: chronic wasting disease; CWD; transmissibility to humans; transgenic mice; prion; cervids; deer; elk; species barrier

Introduction

Prion diseases are neurodegenerative diseases that affect humans

and animals, including cattle, sheep, cervids (deer and elk), and

mink (Sigurdson and Miller, 2003; Jeffrey and Gonzalez, 2004;

Kong et al., 2004). They pose a serious threat to public health

because they can be transmitted between humans and from animals

to humans. Animal to human transmission was dramatically

exemplified by the sudden appearance of a new form of

prion disease, identified as variant Creutzfeldt–Jakob disease

(vCJD), in the United Kingdom, after the emergence of a large

outbreak of bovine spongiform encephalopathy (BSE) (Will,

2003). Compelling evidence indicates that vCJD is acquired after

the consumption of beef or beef products from BSE-infected

cattle (Scott et al., 1999; Will, 2003). To date, five cases of indigenous

BSE, but no case of locally acquired vCJD, have been reported

in North America.

Chronic wasting disease (CWD) is the prion disease that affects

free-ranging and captive cervids, including white-tail deer,

mule deer, and Rocky Mountain elk (Miller and Williams, 2004).

First reported in 1967, CWD was once considered a rare and

geographically contained disease; however, recent data support

the presence of CWD among free-ranging and captive cervids in

at least 13 states in the United States and 2 provinces in Canada,

with a prevalence of up to 20% in some endemic areas (Miller and

Williams, 2003; Miller et al., 2004; Prusiner et al., 2004). These

findings, along with other considerations such as the high cervid

population in the United States (estimated at 22 million), the

several million deer and elk hunters, and the widespread consumption

of elk and deer meat, underscore the likely increasing

risk of human exposure to CWD. These considerations, along

with the recognition that the outbreak of BSE led to the emergence

of vCJD, have heightened concerns about possible directcontact

and food-borne CWD transmission to humans. In fact,

many people are known to have consumed venison from confirmed

CWD-affected cervids. Twenty-seven patients with CJD

who regularly consumed elk and deer meat were reported to the

National Prion Disease Pathology Surveillance Center at Case

Western Reserve University, but none of these cases appeared to

have a novel form of prion disease (Belay et al., 2001, 2003, 2004;

P. Gambetti, unpublished observation); however, human disease

acquired fromCWDmight have an unusual phenotype or a phenotype

that is difficult to distinguish from that of sporadic CJD

(sCJD). This uncertainty is a serious public health concern in the

United States.

To assess the transmissibility of CWD to humans, we generated

transgenic (Tg) Friend leukemia virus B (FVB) mice express-

Received June 16, 2005; revised July 18, 2005; accepted July 19, 2005.

This work was supported by National Institutes of Health Grant 1P01 AG14359-06 (P.G.), Centers for Disease

Control and Prevention (CDC) Grant UR8\CU515004 (P.G.), and funding from the Center for Food Safety and Applied

Nutrition of the Food and Drug Administration through the CDC (P.G.). We thank B. Chakraborty, K. Edmonds, D.

Kofskey, P. Scalzo, and F. Scalzo for technical support as well as M. E. Potter for help and encouragement.

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of

the funding agency.

Correspondence should be addressed to Dr. Pierluigi Gambetti, Department of Pathology, Case Western Reserve

University, Cleveland, OH 44106. E-mail: pxg13@case.edu.

DOI:10.1523/JNEUROSCI.2467-05.2005

Copyright©2005 Society for Neuroscience 0270-6474/05/257944-06$15.00/0

7944 • The Journal of Neuroscience, August 31, 2005 • 25(35):7944 –7949

ing either the human prion protein (PrP) or Rocky Mountain elk

PrP in a PrP-null background. Here we show that, after intracerebral

inoculation with elkCWDprion, the two lines of "humanized"

Tg mice failed to develop the hallmarks of prion diseases

after657 and756 d, respectively, whereas the "cervidized" Tg

mice became infected after 118–142 d. These data indicate that

there is a substantial species barrier for the transmission of elk

CWD to humans.

Materials and Methods

Construction of transgenes expressing human PrP-129M or elk PrP-132M.

The transgene constructs are based on the murine half-genomic PrP

clone in plasmid pHGPRP (Fischer et al., 1996). The HuPrP-129M open

reading frame (ORF) was amplified from the human genomicDNAPAC

(P1-derived artificial chromosome) clone RP5–1068H6 (obtained from

the Sanger Center, Cambridge, UK) with primers HRM-F (TATGTGGACTGATGTCGGCCTCTGCAAGAAGCGC)

and HRM-R (CCACCTCAATTGAAAGGGCTGCAGGTGGATAC).

The PCR product was digested

with PshAI and MfeI and used to replace the corresponding

0.97 kb PshAI–MfeI fragment in pHGPRP to create

pHGHuPrP-129M. In the resulting pHGHuPrP-129M clones, the

signal-peptide sequence is still from mouse, but the rest of the PrP ORF

and the first 76 bp after the stop codon are from human PRNP (prion

protein) genomic DNA. The inserted 0.97 kb PshAI–MfeI fragment in

pHGHuPrP-129M was then sequenced with the primers HRM-R,

HRM-F, and HP306R (CATGTTGGTTTTTGGCTTACTC). One errorfree

clone was chosen for the creation of transgenic mice. To create the

transgene construct expressing elk PrP-132M, the mouse PrP ORF in

pHGPRP was first replaced with the restriction sites for ClaI and NruI by

using conventional recombinantDNAtechniques to create pHGD3. The

ElPrP-132M ORF (eGMSE allele) was selected to make cervidized transgenic

mice because it was reported that all CWD-affected elk and some

deer carried this allele (Raymond et al., 2000). The ElPrP-132M ORF was

amplified from the genomic DNA of an American elk with primers

DePrP-F (CAGTCTAGACCGCGGCATGGTGAAAAGCCACATAGG)

and DePrP-R (ACCTCTAGACCTATCCTACTATGAGAAAAATGAG),

and cloned into pSTBlue 1 (Novagen, Madison, WI). The 0.78 kb ElPrP

ORF thus cloned was released by SacII–XbaI double digestion, blunted

with T4 DNA polymerase, and inserted into the NruI site of pHGD3 to

create pHGDePrP-132M. The final pHGElPrP-132M construct was confirmed

by sequencing. One error-free clone was chosen for the creation

of transgenic mice.

Generation, screening, and characterization of transgenic Tg(HuPrP-

129M)Prnp0/0 and Tg(ElPrP-132M)Prnp0/0 mice. The 12.2 kb HuPrP-

129M and elk PrP-132M transgene constructs were microinjected into

fertilized FVB/NJ eggs, and planted into the oviducts of pseudopregnant

CD-1 mice at the transgenic mouse facility of Albert Einstein College of

Medicine (Bronx, NY). Founder pups were screened by tail DNA PCR.

All founder mice that carry the transgene were bred with FVB/Prnp0/0

mice (Fischer et al., 1996) (kindly provided by the Prusiner laboratory,

University of California, San Francisco) to obtain Tg mice in PrP-null

background. Transgenic PrP expression in the brain and other tissues of

the Tg mice were examined by Western blot analysis with monoclonal

antibodies (mAbs) 3F4 and 8H4 for humanized and cervidized Tg mice,

respectively. All animal experiments in this study were approved by the

Institutional Animal Use and Care Committee and the Institutional Biosafety

Committee, and the use of human brain tissues was authorized by

the Institutional Review Board.

Western blot analysis. Mouse tissues were homogenized in 10 vol of

lysis buffer (10 mM Tris, 150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate,

5 mM EDTA, pH 8.0) with or without 1 mM phenylmethylsulfonyl

fluoride (PMSF). The immunoblotting was performed as described

previously (Pan et al., 2001), with minor modifications. The homogenate

was cleared at 12,000 rpm for 10 min, and the supernatant was then

stored at 80°C. To detect Proteinase K (PK)-resistant PrP fragments

(PrP Sc), brain extracts without PMSF were incubated with 100 g/ml PK

for 1 h at 37°C, and PMSF was added to a final concentration of 3 mM to

terminate the digestion. The extracts were mixed with PAGE loading

buffer (160 mM Tris, 4% SDS, 4% 2-ME, 20% glycerol, 0.04% bromophenol

blue, pH 6.8), loaded onto 12% Tris-glycine SDS-PAGE or 10–

20% Tris-tricine SDS-PAGE gels, transferred to polyvinylidene difluoride

membrane, and probed with 8H4 or 3F4 in conjunction with

horseradish peroxidase-conjugated goat anti-mouse IgG Fc antibody.

Inoculation of transgenic mice. Brain tissues from humans with sCJD or

from elk withCWDwere homogenized and inoculated into the brains of

Tg(HuPrP-129M)Prnp0/0 or Tg(ElPrP-132M)Prnp0/0 mice. Brain tissues

were homogenized in cold PBS, and the homogenate was centrifuged at

1000g for 10 min at 4°C. The supernatant was diluted to 10-fold of the

brain tissue volume in cold PBS to obtain 10% brain homogenate, frozen

at80°C for storage, and diluted to 1% with PBS just before inoculation.

After anesthetization with isoflurane, 30 l of the 1% brain homogenate

was injected into each mouse brain with a 26 gauge needle inserted to a

depth of 2 mm at the left parietal region of the cranium.

Monitoring of symptoms and examination of PrPSc. After intracerebral

inoculations, the animals were visually examined daily for symptoms

such as coarse coat, waddling gait, tail plasticity, and bradykinesia.

Within 2–3 d after the appearance of these symptoms or at death, the

brain was removed; one-half was frozen for biochemical studies, and the

other half was stored in formalin for histology and immunohistochemistry

analysis as described previously (Taraboulos et al., 1992). Total PrP

as well as PrPSc (PK-resistant PrP) were examined by Western blotting in

Tris-glycine and/or Tris-Tricine SDS-PAGE gels, as described above. Sodium

phosphotungstate precipitation of PrPSc was performed as described

previously (Safar et al., 1998).

Terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick

end labeling assay. Terminal deoxynucleotidyl transferase-mediated biotinylatedUTPnick

end labeling (TUNEL) staining of paraffin-embedded

brain sections was performed as described previously (Shi et al., 1990)

with the In Situ Cell Death Detection Kit-peroxidase (POD) (Roche Applied

Science, Indianapolis, IN) according to the manufacturer’s instructions.

Paraffin-embedded sections were dried at 60°C. After the paraffin

was removed with xylene, tissues were rehydrated in serial solutions of

ethanol (100, 95, and 75%), washed in PBS, and subjected to microwave

treatment for 20 min in 60 mM HCl. The slides were then air dried at

room temperature, treated with 5% Triton X-100 at room temperature,

washed in PBS several times, and incubated with TUNEL reagent for 2 h

at 37°C in a humid chamber. The slides were then washed in PBS, incubated

with converter-POD for 30 min at 37°C, developed with diaminobenzidine

substrate according to the manufacturer’s protocol, counterstained

with hematoxylin QS (Vector Laboratories, Burlingame, CA),

and mounted. The TUNEL-positive cells were stained brown.

Results

We used two lines of humanized Tg mice, Tg40 and Tg1, and one

line of cervidized Tg mice, Tg12, that express the transgene PrP in

brain approximately onefold, twofold, and twofold, respectively,

the level of brain PrP in wild-type FVB mice. Both humanized

and cervidized Tg mice were inoculated intracerebrally with

brain homogenates from two CWD-affected elk. The humanized

Tg1 and Tg40 mice were also similarly inoculated with brain

homogenates from human subjects with a type of sporadic CJD

identified as sCJDMM1 (Parchi et al., 1996).

Thirteen of 14 cervidized Tg12 mice inoculated intracerebrally

with CWD elk 1 brain homogenates developed ataxia after

an average of 1186 d postinoculation (dpi) (range, 83–142 dpi)

(Table 1, Fig. 1). All seven cervidized Tg12 mice inoculated intracerebrally

with CWD elk 2 brain homogenates developed ataxia

after an average of 1427 dpi (range, 124–178 dpi) (Table 1, Fig.

1). Histologically, all ataxic mice contained severe and widespread

spongiform degeneration throughout the cerebral cortex

and basal ganglia, as well as neuronal loss in the hippocampus

and granule cell layer of the cerebellum (Fig. 2a,b). Neuronal

apoptosis was detected by TUNEL staining in the hippocampus

(Fig. 2f ), other cortical regions, and the cerebellum (data not

shown). Amyloid plaques were not present; however, immuno-

Kong et al. • CWD Transmissibility to Humans J. Neurosci., August 31, 2005 • 25(35):7944 –7949 • 7945

histochemical staining for PrP revealed

spotted, round PrP deposits, the so-called

plaque-like PrP deposits, similar to those

found in CWD-affected elk, in the cerebral

cortex (Fig. 2d) and the molecular layer of

the cerebellum (Fig. 2e). Symptomatic

mice also accumulated large amounts of

PK-resistant PrP with gel mobility and glycoform

ratios matching those of the original

CWD inoculum (Fig. 3); therefore, the

cervidized Tg12 mice replicated the main

features of the elk CWD PrPSc. Furthermore,

secondary transmission of the elk 1 CWD prion passaged

once in Tg12 mice required an incubation period of 125 4 d

(range, 115–138 d) (Table 1), indicating that there is no species

barrier for elk CWD transmission to the Tg12 mice.

Brain homogenates from the two CWD-affected elk used for

the cervidized mice were also inoculated intracerebrally into 29

Tg40 humanized mice and 22 Tg1 humanized mice. None of the

29 Tg40 mice or the 22 Tg1 mice showed signs of prion diseases

after 756 and 657 dpi, respectively. Three Tg40 mice appeared

to be mildly ataxic before being killed at 420–509 dpi. A

total of 18 Tg40 mice and 12 Tg1 mice died naturally of old age or

were killed because of other illnesses; however, none of the Tg40

and Tg1 mice examined, including the three ataxic Tg40 mice,

had PK-resistant PrPSc as detected by immunoblotting of PrPScenriched

preparations after precipitation with sodium phosphotungstate

(Fig. 4). Histopathological and PrP immunohistochemical

examinations also were negative (data not shown).

Furthermore, the PrP immunoprecipitates obtained from the

three ataxic mice with the mAb OCD4, which immunoreacts

with both PK-resistant and PK-sensitive abnormal PrP present in

human and animal prion diseases but not with normal PrPC

(Zou et al., 2004), were not different from the corresponding

immunoprecipitates obtained from other elk CWD-inoculated

or noninoculated Tg40 mice. Therefore, all CWD-inoculated humanized

mice appeared to be free of detectable prion, and the

cause of the mild ataxia in these three Tg40 mice did not appear to

be related to prion disease.

As positive controls, 10 Tg40 and 7 Tg1 humanized mice were

also inoculated intracerebrally with brain homogenate from a

human subject with sCJDMM1. Nine of the 10 Tg40 mice and all

7 Tg1 mice became symptomatic, with an average incubation

time of 263 13 d (range, 213–315 d) for the Tg40 mice and

2265 d (range, 213–244 d) for the Tg1 mice. The affected mice

revealed fine spongiform degeneration in the cerebral cortex (Fig.

5a) but not in the cerebellum (Fig. 5b), and the vacuoles were

different in size and distribution from those of the cervidized

mice inoculated with elkCWDprion. Apoptosis of neuronal cells

was present but was less prominent than in the CWD-affected

Tg12 cervidized mice (data not shown). After immunohistochemical

staining, fine PrP deposits mimicking the "synaptic"

pattern of sCJDMM1 were found in the cerebral cortex (Fig. 5c)

and cerebellum (Fig. 5d) of the CJD-affected humanized mice,

whereas the plaque-like deposits observed in the elk CWDinoculated

cervidized mice were not present. Abundant PKresistant

PrPSc with gel mobility matching that of the sCJDMM1

inoculum was shown in the brain of the infected mice (Fig. 6a).

The glycoform ratio also was similar to that of sCJDMM1, with

underrepresentation of the diglycosylated PK-resistant PrPSc

fragment (Fig. 6b), but it was quite different from that of CWD.

Discussion

We have shown that CWD of elk can be transmitted to Tg12

cervidized mice with a relatively short average incubation time of

1186 d for elk 1 and 1427 d for elk 2. The PK-resistant PrPSc

of the elk CWD-inoculated Tg12 mice has the same gel mobility

and glycoform ratio as the PK-treated PrPSc of the CWD-affected

elk. The pattern of PrP immunostaining is also similar in the two

conditions. In addition, the secondary transmission of elk 1

CWD passaged in Tg 12 mice to naive Tg12 mice required an

incubation time of 1254 d, which is not substantially different

from that of the primary transmissions. Furthermore, it is associated

with a histopathology and a PrP immunostaining pattern

that is similar to that of the primary infection. These data argue

that there is no species barrier in the transmission of elk CWD to

the Tg12 mice and that CWD-inoculated Tg12 mice reproduced

major strain characteristics of the PrPSc associated with elk

CWD. Recently, Browning et al. (2004) inoculated both hemizygous

and homozygous cervidized Tg(CerPrP) mice that express

mule deer PrP (S2 allele) with brain homogenates from CWDaffected

mule deer and elk. The inoculated mice developed a

disease with histopathological and PrP immunohistochemical

Table 1. Prion transmission in transgenic mice

Prion inoculum Mice PrP (level)

Incubation

time (SEM)

Transmission

ratea

CWD (elk 1) Tg12 Elk PrP-132M (2) 118 6 d 13/14

CWD (elk 2) Tg12 Elk PrP-132M (2) 142 7 d 7/7

CWD (Tg12) Tg12 Elk PrP-132M (2) 125 4 d 5/5

CWD (elk 1/2) Tg40 HuPrP-129M (1) 756 d 0/29

CWD (elk 1/2) Tg1 HuPrP-129M (2) 657 d 0/22

sCJDMM1 Tg40 HuPrP-129M (1) 263 13 d 9/10

sCJDMM1 Tg1 HuPrP-129M (2) 226 5 d 7/7

aNumber of affected/total inoculated animals.

Figure 1. Survival curves of humanized and cervidized transgenic mice. Six- to eight-weekold

cervidized Tg12 and humanized Tg1 and Tg40 mice were inoculated intracerebrally with 30

l of 1%brain homogenate from two CWD-affected elk or a subject with sCJDMM1. The Tg12

mice were also inoculated with brain homogenates from elk 1 CWD-affected Tg12 mice to

evaluate the species barrier of elk CWD transmission to the Tg12 mice. The average incubation

times were as follows: 1186 d for elk 1 CWD-inoculated Tg12 mice (open squares); 1254d

for secondary transmission of elk 1 CWD in Tg12 mice (filled squares); 142 7 d for elk 2

CWD-inoculated Tg12 mice (open rectangles); 26313 d for the sCJDMM1-inoculated Tg40

mice (open circles); and 2265 d for the sCJDMM1-inoculated Tg1 mice (open ovals). None of

the 29 CWD-inoculated Tg40 mice (filled circle) or the 22 CWD-inoculated Tg1 mice (filled oval)

had detectable PK-resistant PrP Sc or substantial histopathology after 756 and 657 dpi,

respectively. The asterisk indicates that three Tg40 mice became ataxic between 420 and 509

dpi but were free of prion infection. Parentheses indicate prion-positive mice per total inoculated

mice.

7946 • J. Neurosci., August 31, 2005 • 25(35):7944 –7949 Kong et al. • CWD Transmissibility to Humans

characteristics that appear overall to mimic the histopathology

and PrP immunohistochemistry observed in our elk CWDinoculated

Tg12 mice. The gel mobility of the PK-resistant fragments

of PrPSc recovered from the Tg(CerPrP) mice also is apparently

similar to that observed in our Tg12 mice; however,

Browning et al. (2004) reported a difference in the glycoform

ratio between the PK-resistant PrPSc fragments recovered from

the Tg(CerPrP) mice and that of the original elk and deer inocula.

At variance with this finding, the PrPSc glycoform ratio of our

affected Tg12 mice reproduced precisely that of the elk CWD

inoculum (Fig. 3b). The incubation time of the CWD-inoculated

Tg(CerPrP) mice varied between 220 and 270 d for the hemizygous

mice and was 160 3 d for the homozygous mice despite

the 3- to 5-fold and 6- to 10-fold PrP expression of the hemizygous

and homozygous mice, respectively. The difference in incubation

time between the Tg(CerPrP) mice and the Tg12 mice

could be caused by the polymorphism of codon 226 [226Q for the

S2 allele used in Tg(CerPrP) mice and 226E for the eGMSE allele

used in Tg12 mice], the PrP genotype difference in the cervid

CWD samples, or the difference in transgene vectors. The short

incubation time combined with the only slightly elevated PrP

expression make the Tg12 mice suitable for bioassay and other

studies on CWD. The short incubation time for elk CWD prion

in Tg12 mice also compares favorably with the incubation time of

238 d reported for BSE transmission to the Tg mice expressing

bovine PrP (Scott et al., 1999).

In contrast to the efficient CWD transmission in the cervidized

Tg12 mice, the same CWD inocula failed to infect the

humanized Tg40 and Tg1 mice after756 and657 dpi, respectively,

the approximate lifespan of these mice, which were 2

months old at the time of inoculation; however, sCJD was transmitted

to these humanized mice with average incubation times of

263 and 226 d, respectively. At variance with CWD, BSE has been

transmitted to a similar humanized Tg mouse model that, like

our humanized Tg mice, expressed human PrP-129M at a level

Figure 2. Histopathology, PrP immunohistochemistry, and apoptosis examination in CWDaffected

Tg12-cervidized mice. Prominent spongiform degeneration was present in the cerebral

cortex (a) along with marked neuronal loss in the granule cell layer of the cerebellum (b) when

compared with age-matched control Tg12 mice (c) (hematoxylin and eosin staining; 20

magnification). PrP deposits formed a fine granular pattern interspersed with plaque-like deposits

(arrow) in the cerebral cortex (d) and in the granule cell layer of the cerebellum (e) (mAb

8H4; 20magnification). Neuronal apoptosis (arrow) was present in the granule cells of the

hippocampus (f ) and in other brain regions (TUNEL; 40magnification).

Figure 3. Characterization of PK-resistant PrP Sc from the donor CWD-affected elk and CWDaffected

Tg12 mice. a, Immunoblot of PrP. Lanes 1 and 2, PK-untreated (lane 1) and PK-treated

(lane 2) PrP from one of the donor elks with CWD. Lanes 3–14, PK-untreated (lane 3) and

PK-treated (lanes 4 –14) PrP from 11 CWD-affected Tg12 mice. b, Glycoform ratio analysis of

PK-resistant PrP Sc. The blots were probed with mAb 8H4. Error bars are based on quantitative

analyses of digital chemiluminescence images of triplicate Western blots of brain homogenates

from an elk withCWD(the inoculum) and duplicate Western blots of 11 Tg12 mice infected with

elk CWD. kD, Kilodalton.

Figure 4. Absence of PK-resistant PrP Sc in elk CWD-inoculated humanized Tg mice. Brain

homogenates were subjected to sodium phosphotungstate treatment to precipitate PrP Sc,

digested with 20 g/ml PK for 30 min, and analyzed by Western blotting with the mAb 3F4.

Lane 1, An uninoculated Tg40 mouse; lane 2, an sCJDMM1-infected Tg40 mouse; lanes 3–5,

three ataxic CWD-inoculated Tg40 mice; lanes 6–8, three CWD-inoculated Tg40 mice killed

because of other aging-related illnesses. Lanes 1, 3– 8, Forty microliters of 10% brain homogenates

were loaded; lane 2, a total of 2 l was loaded. kD, Kilodalton.

Kong et al. • CWD Transmissibility to Humans J. Neurosci., August 31, 2005 • 25(35):7944 –7949 • 7947

two times that of pooled normal human brain (Asante et al.,

2002). The total attack rate was 14 of 49; of the 14 infected mice,

6 had clinical signs, and the other 8 had subclinical infection only,

but all had PrPSc in the brain. The incubation times were 414 d on

average (range, 338–492 d) but as short as340 d in several mice

(Asante et al., 2002). Combined, these findings point to the presence

of a robust species barrier for elk CWD transmission to

humans, which is much more effective than that for BSE transmission

to humans. Because the most likely route of CWD transmission

to humans is through oral consumption of CWD contaminated

meat and the intracerebral route is much more

effective than the oral route (Prusiner et al., 1985), the failure to

detect elk CWD transmission in the humanized Tg mice after

intracerebral inoculations suggests an even lower risk of elkCWD

transmission to humans. This conclusion is consistent with the

lack of evidence of CWD transmission to CJD patients investigated

for a possible causal link of their illness withCWDand with

the low efficiency of an in vitro conversion of human PrPC by

cervid PrPSc (Raymond et al., 2000). Secondary transmission experiments

in naive humanized Tg mice are underway to determine

whether the primary CWD-inoculated humanized Tg mice

are asymptomatic carriers of prion infectivity, although PrPSc is

undetectable in any of these primary mice on Western blot even

after sodium phosphotungstate precipitation or immunoprecipitation

with the mAb OCD4 that selectively recognizes abnormal

PrP associated with prion diseases (Safar et al., 1998; Zou et al.,

2004). Because the CWD prions from deer and elk appear to be

indistinguishable (Williams and Young, 1992; Spraker et al.,

2002) and there have been no reports of different CWD prion

strains, it is likely thatCWDprions from mule deer and white-tail

deer are, as reported here for CWD prion from elk, of low or no

transmissibility in humans.

References

Asante EA, Linehan JM, Desbruslais M, Joiner S, Gowland I, Wood AL, Welch

J, Hill AF, Lloyd SE, Wadsworth JD, Collinge J (2002) BSE prions propagate

as either variant CJD-like or sporadic CJD-like prion strains in

transgenic mice expressing human prion protein.EMBOJ 21:6358–6366.

Belay ED, Gambetti P, Schonberger LB, Parchi P, Lyon DR, Capellari S,

McQuiston JH, Bradley K, Dowdle G, Crutcher JM, Nichol CR (2001)

Creutzfeldt-Jakob disease in unusually young patients who consumed

venison. Arch Neurol 58:1673–1678.

Belay ED, Maddox RA, Gambetti P, Schonberger LB (2003) Monitoring the

occurrence of emerging forms of Creutzfeldt-Jakob disease in the United

States. Neurology 60:176 –181.

Belay ED, Maddox RA, Williams ES, MillerMW,Gambetti P, Schonberger LB

(2004) Chronic wasting disease and potential transmission to humans.

Emerg Infect Dis 10:977–984.

Browning SR, Mason GL, Seward T, Green M, Eliason GA, Mathiason C,

Miller MW, Williams ES, Hoover E, Telling GC (2004) Transmission of

prions from mule deer and elk with chronic wasting disease to transgenic

mice expressing cervid PrP. J Virol 78:13345–13350.

Fischer M, Rulicke T, Raeber A, Sailer A, Moser M, Oesch B, Brandner S,

Aguzzi A, Weissmann C (1996) Prion protein (PrP) with aminoproximal

deletions restoring susceptibility of PrP knockout mice to

scrapie. EMBO J 15:1255–1264.

Jeffrey M, Gonzalez L (2004) Pathology and pathogenesis of bovine spongiform

encephalopathy and scrapie. Curr Top Microbiol Immunol

284:65–97.

Kong Q, Surewicz WK, Petersen RB, Zou W, Chen SG, Gambetti P, Parchi P,

Capellari S, Goldfarb L, Montagna P, Lugaresi E, Piccardo P, Ghetti B

(2004) Inherited prion diseases. In: Prion biology and diseases, Ed 2

(Prusiner SB, ed), pp 673–776. Cold Spring Harbor, NY: Cold Spring

Harbor Laboratory.

Miller MW, Williams ES (2003) Prion disease: horizontal prion transmission

in mule deer. Nature 425:35–36.

Miller MW, Williams ES (2004) Chronic wasting disease of cervids. Curr

Top Microbiol Immunol 284:193–214.

Figure 6. Immunoblots and glycoform ratios of PK-resistant PrP Sc from the sCJDMM1 donor

and sCJDMM1-inoculated Tg1 mice. a, Immunoblot of PrP. PK-untreated (lane 1) PrP and PKtreated

(lane 2) PrP were obtained from the sCJDMM1 donor; PK-untreated (lane 3) PrP and

PK-treated (lanes 4 –10) PrP were obtained from the seven sCJDMM1-inoculated Tg1 mice. b,

Glycoform ratio analysis of PK-resistant PrP Sc. PK-untreated and PK-treated brain homogenates

were processed as in Figure 2, but blots were probed with 3F4. Error bars are based on

quantitative analyses of digital chemiluminescence images of triplicate Western blots of brain

homogenates from a subject with sCJDMM1 (the inoculum) and duplicate Western blots of the

seven Tg1 mice infected with sCJDMM1. kD, Kilodalton.

Figure 5. Histopathology and PrP Sc deposition in the brains of sCJDMM1-infected Tg40

mice. In the brains of sCJDMM1-infected Tg40 mice, hematoxylin and eosin staining revealed

moderate spongiform degeneration with fine vacuoles in the cerebral cortex (a) accompanied

by even milder spongiosis in other brain areas (20magnification), but the granule cell layer of

the cerebellum (b) appears mostly intact (40 magnification). Immunohistochemistry for

PrP Sc with 3F4 revealed fine PrP Sc deposits in the cerebral cortex (c), with more intense PrP Sc

deposits in the cerebellum (d) (20magnification).

7948 • J. Neurosci., August 31, 2005 • 25(35):7944 –7949 Kong et al. • CWD Transmissibility to Humans

Miller MW, Williams ES, Hobbs NT, Wolfe LL (2004) Environmental

sources of prion transmission in mule deer. Emerg Infect Dis

10:1003–1006.

Pan T, Colucci M, Wong BS, Li R, Liu T, Petersen RB, Chen S, Gambetti P, Sy

MS (2001) Novel differences between two human prion strains revealed

by two-dimensional gel electrophoresis. J Biol Chem 276:37284 –37288.

Parchi P, Castellani R, Capellari S, Ghetti B, Young K, Chen SG, Farlow M,

Dickson DW, Sima AAF, Trojanowski JQ, Petersen RB, Gambetti P

(1996) Molecular basis of phenotypic variability in sporadic Creutzfeldt-

Jakob disease. Ann Neurol 39:767–778.

Prusiner SB, Cochran SP, Alpers MP (1985) Transmission of scrapie in

hamsters. J Infect Dis 152:971–978.

Prusiner SB, Williams E, Laplanche J-L, Shinagawa M (2004) Scrapie,

chronic wasting disease, and transmissible mink encephalopathy. In:

Prion biology and diseases, Ed 2 (Prusiner SB, ed), pp 545–594. Cold

Spring Harbor, NY: Cold Spring Harbor Laboratory.

Raymond GJ, Bossers A, Raymond LD, O’Rourke KI, McHolland LE, Bryant

III PK, Miller MW, Williams ES, Smits M, Caughey B (2000) Evidence

of a molecular barrier limiting susceptibility of humans, cattle and sheep

to chronic wasting disease. EMBO J 9:4425– 4430.

Safar J, Wille H, Itri V, Groth D, Serban H, Torchia M, Cohen FE, Prusiner SB

(1998) Eight prion strains have PrP(Sc) molecules with different conformations.

Nat Med 4:1157–1165.

Scott MR, Will R, Ironside J, Nguyen HO, Tremblay P, DeArmond SJ,

Prusiner SB (1999) Compelling transgenetic evidence for transmission

of bovine spongiform encephalopathy prions to humans. Proc Natl Acad

Sci USA 96:15137–15142.

Shi B, De Girolami U, He J, Wang S, Lorenzo A, Busciglio J, Gabuzda D

(1990) Apoptosis induced by HIV-1 infection of the central nervous system.

J Clin Invest 98:1979 –1990.

Sigurdson CJ, MillerMW (2003) Other animal prion diseases. Br Med Bull

66:199 –212.

Spraker TR, Zink RR, Cummings BA, Wild MA, Miller MW, O’Rourke KI

(2002) Comparison of histological lesions and immunohistochemical

staining of proteinase-resistant prion protein in a naturally occurring

spongiform encephalopathy of free-ranging mule deer (Odocoileus

hemionus) with those of chronic wasting disease of captive mule deer. Vet

Pathol 39:110 –119.

Taraboulos A, Jendroska K, Serban D, Yang SL, DeArmond SJ, Prusiner SB

(1992) Regional mapping of prion proteins in brain. Proc Natl Acad Sci

USA 89:7620 –7624.

Will RG (2003) Acquired prion disease: iatrogenic CJD, variant CJD, kuru.

Br Med Bull 66:255–265.

Williams ES, Young S (1992) Spongiform encephalopathies in Cervidae.

Rev Sci Tech 11:551–567.

Zou WQ, Zheng J, Gray DM, Gambetti P, Chen SG (2004) Antibody to

DNA specifically detects scrapie but not normal prion protein. Proc Natl

Acad Sci USA 101:1380 –1385.

Kong et al. • CWD Transmissibility to Humans J. Neurosci., August 31, 2005 • 25(35):7944 –7949 • 7949TSS

>>>Because the most likely route of CWD transmission

to humans is through oral consumption of CWD contaminated

meat and the intracerebral route is much more

effective than the oral route (Prusiner et al., 1985), <<<

WHAT about humans exposed to the CWD agent via sub-clinical humans whom consumed CWD tainted meat, THEN had a surgical/dental/eye procedure and passed the agent via surgical/dental/eye procedures or donated organs???

would this be fear mongering or a plausible route of potential transmission???

what about second passage???

kind regards,

terry




Follow Ups:



Post a Followup

Name:
E-mail: (optional)
Subject:

Comments:

Optional Link URL:
Link Title:
Optional Image URL: